Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896522
Length 722 bp
Fasta Format > whthkles10g05
ccccctccggcttccagaagcttctcgacgacgccatgcgtccggccatc ctcgccgccgtcctcctcctcctcgccgccgcggcctccccggcggccgc gctctactccgccggctccccggtcctccagctcaaccccaacaacttca agaaggtgttgaacgcgaacggggtggtgctggtggagttcttcgcgccc tggtgcgggcactgcaagcagctgacgccgatttgggagaaggccgccgg cgtcctcaagggcgtcgccacggtcgccgcgctcgacgccgacgcgcaca aggagctcgcgcagcaatatggaatacagggattcccaaccataaaagta tttctccctggcaagccaccagtggattatgaaggagcaagagatgtaaa ggcaattgtaaattttgctctgtcgcaggtcaaaggtcttctcagagata ggttggatggtaagacatcaggaggttcaagtggcaaaacctctggtggc tcaagggagaaaaaaactgaaccaaatgaatcagtagaattgaattcgag taactttgacgaactcgtcgtcaaaagcaaggatctttggattgtggagt tctttgcaccgtggtgtgggcactgcaagaaattggctcctgaatggaaa agggctgcaaagaacttgaagggtcaagtgaaactaggccatattgattg tgactctgataagtccttgatg
Download
page-top