Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896521
Length 705 bp
Fasta Format > whthkles10g03
aaccctactctctcccctcctcggctcctcccctcgcgagcggcgacgaa gaggccatggatacctccggcggcggcaccgccgcgggcggggccgcgca gatccaggggatggcgacacacggcggccgctacgtgctctacaacgtct acggcaacctcttcgaggtcgcctccaagtacgcccctcccatccgcccc atcggccgaggcgcctacggcattgtctgcgcggcggttagttcggatac aggagaggaggttgcgatcaagaagattggaaatgcgtttgacaaccaca tcgatgccaagcggacgctgagagaaataaagcttcttcgccacatggac catgagaatattcttgccataaaggatttaatacgccccccaagaagaga tgattttaaggatgtgtacattgttactgagttgatggacaccgacctcc atcagatcattcgctcaaatcaatcattgactgatgaccattgccagtac ttcttgtatcagttgcttcgagggctaaaatatgtgcactcagcaaatgt cttgcaccgtgatctgaagccaagcaatttgttcctaaacgcaaattgcg atctcaagattgcagactttgggcttgcaaggaccacttcagaaaccgat ctcatgacagagtatgtggtcactcgttggtaccgagcaccagagttgct gttga
Download
page-top