Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896520
Length 668 bp
Fasta Format > whthkles10g01
caatcggaacggaaatcccccgcgccgcacgccgaatccgtcgccggaat ccatcgaccgatccggccggccagccggcgagagcaggggcgcggagatg gtgagcgccttcttcctcttctgcgggtgcgtggagcaggcgaacgtggc ggtggtcgagaagtggggccgcttcctccgcctcgccgagccgggcctcc acttcttcaaccccttcgccggcgagctcgtcgccgggaccctctccacc cgcgtccagtcgctcgacgtcaaggtcgagaccaagaccaaggataatgt gtttgttcagctgatctgtacaattcaataccgggttgttaaggagaatg cagatgatgcgttctacgagttgcagaatccccaacagcaaattcagtcc tacgtctttgatgtggttcgagccatagttccaagaatggagctggacag tctttttgagcaaaagaatgatgttgcaaaggctgtacttgaggagcttg aaaaggtgatgtcagattacggttacagcattgagcacattctcatggtt gacatcatccctgatgctgctgtccgcagagcaatgaacgacataaatgc agcccaacggctccagcttgcgagtgtctacaaaggagaagcggagaaga tccatctggtgaagaagg
Download
page-top