Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896516
Length 715 bp
Fasta Format > whthkles10e17
gcatcacacccacacgccccctccaacgcagccagagagaaagagaatgg cgagccaaggtgttgcctccatgttcgctctggcattgctcctcggagcc ttcgcctccatcccacaaagcgtcgagtccatcggggtgtgctacggcat gagcgccaacaacctgccggcggcgagcaccgtcgtgagcatgttcaagt ccaacggtatcaactccatgcggctatatgcccccgaccaggcggcgctg caggccgttggcggtacgggcgtcaacgtcgtcgtcggggcgcctaacga cgtgctctccaacctcgccgccagcccggcggcggccgcctcgtgggtca ggagcaacatccaggcctacccgaaggtttcctttcggtacgtctgcgtc ggcaacgaggtcgccggcggtgccacccagaacctcgtcccggccatgaa aaacgtgcagggcgcgctcgcctccgctgggctgggccacatcaaggtca ccacgtcggtgtcgcaggccatcctcggcgtgtacagcccgccctccgcc gggtccttcaccggggaggcggacgcgttcatgggccccgtggtgcagtt ccttgcccgcaccggcgcgccgctcatggccaacatctacccgtacctgg cctgggcctacaacccgagcgccatggacatgagctacgcgctcttcacc gcgtccggcaccgtg
Download
page-top