Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896508
Length 712 bp
Fasta Format > whthkles10c15
ccccactgtgatggcttcctcggccacctccgtcgcacccttccagggtc tcaagtccaccgcgggcctgcccgtcagccgccgctccagcagcgccggc ctcggcagcgtcagcaacggcggaaggatcaggtgcatgcaggtgtggcc gattgagggcatcaagaagttcgagaccctgtcttacttgccacccctct ccacggaggccctcctgaagcaggtcgactacttgatccgctccaagtgg gtgccctgcctcgagttcagcaaggttggcttcgttttccgtgagcacaa cagctcccccgggtactacgatggtcgatactggacaatgtggaagctgc ctatgttcgggtgcaccgacgccacacaggtgctcaacgaggtggaggag gtcaagaaggagtaccctgacgcctatgtccgcgtcatcggcttcgacaa cctgcgccaggtgcagtgcgtcagcttcatcgccttcaggccaccgggtt gcgaggagtctggcaaggcctaaactacgagttgaaacaatggcctatgt atgaaggtcttttgtgaacttaacttttgtccaccactctgctggacgac cagagcatatttttcattctatatggtctgtgtgtgtatgtacgaacata ggttctcgagcatgcatatgtaaattctagaaccggctacacatatacaa aacctgtgtgat
Download
page-top