Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896507
Length 415 bp
Fasta Format > whthkles10c13
tggatggcaagagggtgtatgtnaccaactctctcttcagccggtgggac gagcagttctacggccctgaccttctcaagaagggatctcacatgttgca gatcgacgtcgacactgaggaaggagggctggctgtcaaccccaacttct ttgttgatttcgggaccgagcctgaaggtccctccttggcccatgagatg agatatcctggtggagactgcacctctgacatatggatctaggaggaagg gtgtaggacacaggcagctggagatccatggtgttgagctcactgtaatt aaaatggtctcttccccgcctgcggtgttgtatgtgatgtggtatcaatt ggaataagttcctgatagaacctctgacattggcttcatgggagctttgg gccctaaaaaaaaaa
Download
page-top