Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896496
Length 702 bp
Fasta Format > whthkles10a11
gccacaactcggagggcgtgctgctgccgctcaacgagccggtgcacggc accaagcgccggagccagatacagacgttcctggaacaccacggcggctc gggcgtgcagcacatcgcggtggccagcagcgacgtgctcaggacgctca gggagatgcgtgcgcgctccgccatgggcggcttcgacttcctgccaccc ccgctgccgaagtactacgaaggcgtgcggcgcatcgccggggatgtgct ctcggaggcgcagatcaaggaatgccaggagctgggggtgctcgtcgaca gggacgaccaaggggtgttgctacaaatcttcaccaagccagtaggggac aggccgacgttgttcctggagatgatccagaggatcgggtgcatggagaa ggacgagagaggggaagagtaccagaagggtggctgcggcgggttcggca aaggcaacttctccgagctgttcaagtccattgaagattacgagaagtcc cttgaagccaagcaatctgctgcagttcagggatcataggatagaagctg gagctggaggagctgatccagtactttgtatcaggtctcatggagcaaaa gaaaatgatgttgtttgtaagatgcggcgcgcaattatgtccgatgttat aattggtgaagctgaagacagatgtatcctatgtatgatgggtgtaatag at
Download
page-top