Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ896495
Length 755 bp
Fasta Format > whthkles10a09
ccaccctcgaccgcagcgacccacagcggcgcaaccatggtgctcgagtc gacgatgatctgcatagacaactcggagtggatgcggaacggcgactact cgccgtcccgcttccaggcgcaggccgacgccgtcaacctcatctgcggc gccaagacccagtcgaacccggagaatacggtgggcgtcatgacgatggc cggcaagggcgtgcgcgtgcttgtcactcccaccagcgacctcggcaaga tcctcgcctgtatgcacgggctggaagttggagctgaagcaaacttggcc gcagctattcaggttgctcagctggcgctaaagcatcgccagaataagag gcaacagcagagaattattgttttcattggaagccctgtgacatacgaca agaaggttttggagacaatagggaagaagctgaagaagaataatgttgcc cttgacgttgttgattttggtgaaactgatgatgaaaagcccgagaaact ggaagcgctgatcgctgctgtgaacagcagtgatagcagccacatcgtcc atgtccctccgggtgatcatgccctttctgatgttcttataagcactcct atctttactggtgaagaaggtggaagtggctttgctgcttctgcagcagc tgctgcagccaccggagctactggatatgattttggcgtggacccaaatg tggatccagagttggcacttgccctacggttgtctatggaggaagaacga gctag
Download
page-top