Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208668
Length 196 bp
Fasta Format > wh10d20
ccgtgcagcagcgccgngccgaggcttactccaagnctccnaagtgggtt ttctgaatatatggctaatggaggtgaatgcgcctatcaacaactatgtg ggaatgttacagccgaatttaatgattgctcaacacagattcttgaaatg gtgtccctcctgtcaaagccaagtttttgtcgtggagatcttgcca
Download
page-top