Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884709
Length 868 bp
Fasta Format > whthls10f01
aagcttccgcacaccagcagaagtttgcagatacaaacgataacactgca tcacagtatatggtatacaaacaaagacagttcaggcatcaacggacaca gaccagactccattggaggacaccgaggacaacgagacttgtgaacccag agacagaagcagatccatggccaggagcttactggccaccgcgcagacgg agcaccaagtgaagtgtggactccttctggatgttgtagtccgccaaagt gcggccatcctcaagctgcttgccagcaaagatgagacgctgctggtccg gtgggatgccctccttgtcctggatcttggccttgacgttgtcgatggtg tcagaggactcgacctccagggtgatggtcttgccggtcagggtcttgac gaagatctgcatgccaccacggagcctgagcaccaggtggagtgtggatt ccttctggatgttgtagtcagcgagcgtgcggccatcctcgagctgcttg ccagcaaaaatgagacgctgctggtccgggggaatgccctccttgtcctg gatcttggccttgacgttgtcgatggtgtcagaggactcaacctccagga tgatggtcttgccggtcagggtcttgacgaagatctgcatgccaccacgg agtctgagcaccangtggagtgtggattccttctggatgttgtantcagc cagggtgcggccatcctcgagctgcttgccancgaaaatgaaacgctgct gatcggaagggatgccctccttgtcctggatcttagccttgacgttgtcn atggtgtccgaggactcaacctcnangntgatggtcttgccggtgagggt ctncnnaaaaatctgcat
Download
page-top