Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884700
Length 766 bp
Fasta Format > whthls10e14
atattatgcgtccgtgcatatacatagccaccgatagcattcacatacga gcatgctttctcgagccatgttcgtacatgaacatggacatacacatatt cttaggaacaaataagaaagataaatggagaaggaaaacccaaagcaatg tcagagttgacaaaactgcaatggcactttatatatggcctgtcgtgagt gagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcg atgaagctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcg gacataggcgtcagggtactccttcttgacctcctccacctcgttgatca cctgcgtggcgtcggtgcatccgaacataggcagcttccacattgtccag taccggccatcgtagtacccaggggatgcgttgtgctcacggaagatgaa cccaaccttgctgaactcgaggcaaggcacccacttggagcggatcaggt agtcgacctgcttaaggagggcctccgtgctgagcggtggcaagtaggac agggtctcgaacttcttgatgccctcgatgggccacacctgcatgcacct gatccttccaccgttgctgacgctgccgaggctagcgccgttggagcggc ggctgacggggaggccggcggtggacttgagcccctggaaaggagcgacg gangtggccgacgaggccatcacggtgggggccatggctgtactatgtan gtatatagcttgctag
Download
page-top