Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884697
Length 917 bp
Fasta Format > whthls10e10
atcggacggcagccctttcgggggttccttagggaccgattcactctgcg tagattgactgaacgcagaaagccttccactggcaggcgatcgtgttttt cacaggatttctcgttactcatgtcagcattctcacttctgatatctcca ggtcttgtcaccaaaaaccttccccgattgacagaacgtcccgctactga cacttgaaaaagctgctttcaaggtctcgtcgcttcggtgaatcacttga gccctgagacattttcggtgccatggagctagaccagtgagctattacgc tttcttcaaaggatggctgcttccaagcccacctcctggttgtcatcgct cgatcacttccttttccactaagtgattgcttagggaccttagcgtacga tctgggctgtttccctctcgactttggatcttagcacccaatcagtctgt ctgtactaaggatgacggcctgtattcggagtttccctggggttggtaaa gcgaaatgggggccaccctagcccattgagtgctctacctcgggccatcg acatcatacgctctactgaaatagatttcgcggaaaaccagctatatccg atcttggttggcctttcacccctagccacaagtcatccccgtattttgcc acatacgtgggttcggtcctccaaggcctgttagagctctcttcaacctg ctcatggctagatcgatcggtttcgggtcaaataggaagaacgtaaatct tccacctctggaaagcgcctacacctaatggcttaagccgctgttcccat ttcctcgctgacccatcatgcgaaaggtacgccgttagagtgagtgcgcc cgcgctccgctccttcgactgattgttcgcatcggatctcaggttctcta ttgcactccccgattgg
Download
page-top