Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884694
Length 756 bp
Fasta Format > whthls10e05
acaatccataaaaccttcagcatgaaaacatgtcctttccttttgctcga aaagaaacacgtctttcacgcatcattagcttaactaggtagatagcaaa aaaaaaacacttagctaataggtggattctgcaaggcatccaagcttctg cctattcgctcttctatccaggcaagtctcctctcaagttttagcacact ggtatgcagaaccctaacatcaacttctgcaagctttgcaaatgagcgta tcaacacgtaataatcagcatgtccgatgcaaacaagactaccggttatt gtcttccttctatagtgaaggtacccatttgacctaagccacttccttgg cggcagataacaaaacccatgatcctccatttccgacttaatcctttgca cccctgatgatgatgcanaaaagctccttgcaccaacagaagttccatcc cggcatcgtttattcatcactccattcgtggttcgcgtttcctccatgcg agcttttggattcccatcctctcgtcctttgtacatatccngaaagatct ctattaagtgatcctcttcaactgaacatgaaatcccagggaaaacaata tctttgcaatatttgagataagagtgaaggtcctttgaatagtcatgcgc aacatcaattttatcataggcacttgcaagagtgcatagcaattcctttg tgccaaattcctcactagtgccgccttcaggcctcttaaatggtggtaaa tttgca
Download
page-top