Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884693
Length 658 bp
Fasta Format > whthls10e04
tctatatttgtgattgatgcggtataaaatgaatgtccatcagttctcaa caagctaaaattcatcggcccaaatgcaaacacgactttaggcaattggg ccatagcaagtacagaagagaggatgggtagagaaaaaaaaagcctacaa agaaaatgccgggtgcttccatcttccaggagcagggagacttcaaaaac aaacaccgagctcttcctttactactagttgcagttaggggtccgggaga aggcctggaagctgaatcgaatttaccaaggggccattggctcacccgga tgccaatactcttagaatctgaaatccggctcgacgtccattgcccatcc aaactttgcaagaattgtcttgctgaaaatcttctcaatagggacttcat gggttttgcaccatgctaccgtaattctagggtcaaggtagttgatcttt gatgtccctaatgctaccgtcttcaaatcctctttcgtcttcttatccat ctccattttctctaccttggtttctatctgagagatcttcttctcaatcg cttcaggtgccaaagctctctttggcttcccatctgcaccgttgcctaga ggctttcctctcttcactttgcccaaatctttgttcagctcatttatctg ggccttta
Download
page-top