Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884691
Length 169 bp
Fasta Format > whthls10e01
ctgtttaggccttgccggactcctcgcagcccggtggcttgaangcaatg aanctgacgcactgcacctggngcatgttgtcgaatccgatgatgcggac gtacgcgtcanggtactccttcttgacctcctccacctcgttgatcacct gtgtggcttcggtgcaccc
Download
page-top