Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884679
Length 572 bp
Fasta Format > whthls10d09
gtatacaaatattcagatacatctggttagctacacattatgtactgtgt ttatactctgctataatggatacctactatctgccaatgtgcagtcacac tatcacaggaatatatttgcacctagtcttcatggttcaaaagttgggac ttgagcagaaacaccctgagttgcctggtacacagcacgctgagctatac tcctgtaagggtcttcctccctcttcctctgtaagtatgccattgcgttc tcgacttctgatttgatatgtaaatacactttatttgcgctctccctgtc cgtcagaacattgttcatcccttccattttgattggtttgccaaaaaggt agtagaatcgtcccggtactttgggaacaatagcaggtatgtgcatgtcc tgattcccttcctctcctttgacgctatctctcactctctggccgtcttt gttgattgactctatccactcccgaaggtacgggatgttcttttgatcat tgtaatccagaaccaactctaaaatgtcatcttctccgacaaacccaaat ggaacgactgtaacaccaaacc
Download
page-top