Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884677
Length 700 bp
Fasta Format > whthls10d07
attgtataatattatgcgttccgttcatatacatagccaccgatagcatt ctcatacgagcatgctttctcgagccatgttggtacatgaacatggacat acacatattcttaggaacaaataagaaagataaatggagaaggaaaaccc aaagcaatgtcagagttgacaaaactgcaatggcactttatatatggcct gtcgtgagtgagctgtttaggccttgccggactcctcgcagcccggtggc ttgaaggcgatgaagctgacgcactgcacctggcgcatgttgtcgaatcc gatgatgcggacatacgcgtcagggtactccttcttgacctcctccacct cgttgatcacttgtgtggcgtcggtgcacccgaacataggcagcttccac attgtccagtaccggccatcatagtacccaggggatgcgttgtgctcacg gaagatgaacccaaccttgctgaactcgaggcaaggcacccacttggagc ggatcaggtagtcgacctgcttgaggagggcctccgtgctgagcggtggc aagtaggacagggtctcgaacttcttgatgccctcaatgggccacacctg catgcacctgatccttccaccgttgctgacgctgccgaggctagcgccgt tggagcggcggctgacggggaggccggcggtggacttgagcccctggaaa
Download
page-top