Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884671
Length 770 bp
Fasta Format > whthls10c23
attgatgattacacgaggaccagagcacccaaacggcaagggaaaacaat caatagtagccttgtgtgtttgacacgcctcttgccacccaccacccaga gacgagagaagagcgaccagacaccctgatgcatgacgacgacgacgatg atgcgacctacctaagcggactacgcgtagtatgcaaccaaacggaaaat caaatatgttggaagaatttcgtccaaatcctccagtggccacccaccaa atccaacccaacccatcactgatcatcgcacggcgatcggcgccgatcgg cttcagggcttccacaggatggtggtctcggcgatcatcgaggtgaccac gtatgggtccatgttggacgccggccggcggtcctcgaagtagcccttgc cgttctgctccgtctcccggcccacgcgcaccgacgcgccacggtttgcg acgccccagctgaaggtgttgatgtcggcggtctcgtgcttgccggtgag gcggcgctcgttgccctcgccgtaggcggcgatgtgctccttgtgcttga gcttgagcttctccacggcatccacgatgaccttgaacccgccgtccttc ctcatcgactcggtactgtagtttgtgtgagcaccagcaccgttccagtc gcctgggatgggcttggggtcaaatgtgacgacaactccggcgatctcag tgatcctctcaagaaggtagcgagcgacccacacttggtcgccagcagaa atgcccaacagtcgggccga
Download
page-top