Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884670
Length 566 bp
Fasta Format > whthls10c22
gcgatccaagaatagtaatagcggatacagaccacatacaaatgatcgta caagcaaaaaagtagaagaacgttaataagcaggaatagccagtaccagt ctaaatacttttattaactgtaaacttctgtttctggttttattttttcc aataccttctcagcatcaataaagccccctaagggacccaacggtgtata ttttacttgcctccaactgggtataaatggcaatgccaggcagtgaagat ggaggtgatcaatactattaaatggtggctgatgaaaaccaaatctatgt tcctcagatttgggagcatctcgactgagtaaatcttttcccaccttcac catgtgactaactaactggtgatcttcgttggttctttggagatttttta cagttggtatatgctcaacgggtatgacaagatagtgcctgaacgccgac ggattgatgtcctggaacgccacgaccttgtcatcggagtagaggaggac ggcggtggaagcgggggcgcggcggccgatgtcgcagaagacgcaccagt ccgccatcggcgtccg
Download
page-top