Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884665
Length 383 bp
Fasta Format > whthls10c17
tatgagcctatcctctatcttcttttttatgtttatatttcaatataccg aaacctatataagactagataaatattaagaggactcttccgcctagata aaaatatatcatggtcagcaaagttgtttctttatttttatttgccctct ttaataatttcaatttcattaagaaaaactaactaaataaatggaaaatg aaaattaatagaattctttttttttttnctncaaanccaaaaaattnccc ttttttanncanaggncgccnatncggcntgggttaaaaangggcngggg gccccctttttttttncaagaaaanantncacccccgggccnaatnccgg cacccngggggacccncnantncnanngggncc
Download
page-top