Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884664
Length 879 bp
Fasta Format > whthls10c16
gtcaagaagtgaagaaaacgataacattcgaacacatagaaggagaaatt acaaaataccaaactcaatactacgaataatctggatctttttgtacggc cgagtactacactcgggcgaagagcagccaaagatgcccccaatagttct caacgctatccagatgtgtataactgttaatatctgttatccggacaagc tgtcctctggggaaaggttgagttaatgcttcaagggataagcgcttcca tcgaattttgcaacagcctcattcggcttgggcgtctccaatctctcctc tctcttcttcttttccctctcgatgtattccttgagaagttccttggctt gaaccagtttcgagagtaagttgcggtaaacgtcaaggtctctatccacg ctctttttattgatgtttagagcagcacaaagcttgtccagtacggttgg ctccgtcgcatttgagagctcaagcaaacggaacaagccaacagcaaaga accggctgtagctgaagtttcccttaccctgggccctttctgatatatct ttcagaatggactctatttccccatctctggaagaaaattcaactaacaa gttaccattttgtgagcgtgcccactcttccatcctttgtgcatcagccc tgtattgctcaggatcttcatttaacgccgttacgtatgacttgaagatg gcatccctgtcctcggtgctggggtacccttccataagctggtcatagac agtgacaaatccaagagcaaacacaggatcatactgataggtacttttgt atctcatcagatgttgctgcaccaaaagttcttgtaggactgtactgtaa atgcttggaataggacgtttgtatgactt
Download
page-top