Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884663
Length 526 bp
Fasta Format > whthls10c14
taggtatactcaatatctttatatattaacaaaacatgcccagcaatcgc ttggatgcgatgcggtacttaggtacaaaggataaaacatcagatattaa attggcatgcttaaaaggtgtaaaggcagctgccgtcgtcactcctcgcc gttgggtcgaagttcttggcagtctggtcggtgcatcctgccggtacagg caaagtaccttgctgtgcccctttacctcctcctatgcagcaagagatgg tgggtgtgtatggagaatgttctaaccgtagaaggtaccagtcttcatcg catcctggttagcatcacccagagctgcctggctcatgtaggtgtcagca agctgcacacgcttgacattgtcctgctcctggacgagcatgtgcccgta ctctagcagcttctccactgtcatctttggctgctcaaaggtcactggtc cgtcccgcgagttcaccagcttcttgccaatgttctcgataccggtagag gtcacccacttgcgcacctcgtcgtc
Download
page-top