Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884662
Length 760 bp
Fasta Format > whthls10c13
aatattatgcgtccgtgcatatacatagccaccgatagcattcacatacg agcatgctttctcgagccatgttcgtacatgaacatggacatacacatat tcttaggaacaaataagaaagataaatggagaaggaaaacccaaagcaat gtcagagttgacaaaactgcaatggcactttatatatggcctgtcgtgag tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggc gatgaagctgacgcactgcacctgacgcatgttgtcgaatccgatgatgc ggacataggcgtcagggtactccttcttgacctcctccacctcgttgatc acctgcgtggcgtcggtgcatccgaacataggcagcttccacattgtcca gtaccggccatcgtagtacccaggggatgcgttgtgctcacggaagatga acccaaccttgctgaactcgaggcaaggcacccacttggagcggatcagg tagtcgacctgcttaaggagggcctccgtgctgagcggtggcaagtagga cagggtctcgaacttcttgatgccctcgatgggccacacctgcatgcacc tgatccttccaccgttgctgacgctgccgaggctagcgccgttggagcgg cggctgacggggaggccggcggtggacttgagcccctggaaaggagcgac ggaggtggccgacgaggccatcacggtgggggccatggctgtactatgta gcctcgtgcg
Download
page-top