Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884661
Length 517 bp
Fasta Format > whthls10c12
gtatatacacgagatggtatcactgtataaggtcgtgcatggcggtagag taacttgtgatgatacgttacatacattacataggaggcatgcattgatg ccgcatatagtatatgcgtctaggccgccgttccgttacataaaccgatc gatccttgcattgttttggaagatgaggcctgcgcacgggtgtaattagg gctggccacctgccggtggtacattacagccgtaaattttgctgcacgga cgaccggtgtagggtttaccaggcggcgacggaaaagcagggtggttagg gtcgttgctaccagtgcctactacagtggcgtcgtggccagcggctccaa ggcagacggagctgttcatgatcaccgcggcgacgacgaggaagagagcg atctgctggagcaccgtgggacgacggccggcagaagccatgctgatgat tcgatgctgctagctaatgattcgagcgaggctttgagagctgggcagct agctatgtacgtcctgc
Download
page-top