Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884660
Length 819 bp
Fasta Format > whthls10c11
agccaagaagtttaaagggccctcttatattttggataatactttgacta caaatttgaccaaagccatactccctccttttcacaatgtagtgagtatt actaggctttcaaaaaacaaaggatgaagcggcaataattcatatcgtag aagtctgtcatatatcacaaaaagggaagttgcccgtttatagttcctat tgcaccacatggccttcatgatgcctttgcacggggccattgacatacgt atatgacacgtcttctgttttcagaagcttatggtcaaagaaagcgctat aacagccgttgctagccttattaatcccgcatatatgatcattttttgcc aattaattcaccttggagcagctgagcctgacctggccctgcgagccgct caacgggctaaggttccccatcttcaccatggccgaggcgaaggcgctgc tgaacgccgctggggtgcttgcgaagttgttgacgatgttgtcggtgccg ccgccggtgcccgtgaataggacctggtcggagtgcaggagccccttctg ggacttgaggttgctgtagtaagcgttgtcaaaggagtatggggtcgaca cgtccagattggccaggttgcggtcgccggagccggtcggctgggggcag ttggctttgagcgacgtcgcgaagccggagttgatgttggtctcgttgta gagtctgtccctgaagttctggcactgcgcctgcccaaatagtgtgggcg ccggagagggcgaccatgtcggtcacggtgaagcccttgtcaccgaagga ctgggtgaggttaacgagg
Download
page-top