Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884658
Length 852 bp
Fasta Format > whthls10c09
ttcgctcatttgacttacaacggcgagaatcatcattttatttactcact gcctctgttgcagcagcatatatactcggtggattctcatcccatcctga catccttcaggtctccactctctcgatcagcttgatgcccgccgcttcca agatctccagcgcagggatgtagatctccggctccagaggccggatcacc cctttcctctggaccttgttctggagcaagagcagggctcctatcgctgc cggtaccccgacggtgagggccatggcggtggtcgacctgccattctcgg tctttccgaactccagcagcgtcgcttggtgcttttcggttggtcgcccg tcggagtactccacctcgacttcatggtggagcagtaccatatcctgctc attgtggccataggccattctctgttccatacgttggcaaataacactga atgcacttgaacaatccttaggaatctgtgtctcctcatgcagccccaag aacttgatggttttgagtatcttgacagctagttccttttctttgcaatg cccaagcatcatgagtcttgaaatcagttcatcgtcatgtcctccagttt cttcaccatttacctttgtgttagatgtggatacattgttgacattaagg agttcgttgagaaaaatcctatatgttgggcgattagtttcttgtagcag tggatgattttcagcatcaaaaaacccaattttcgccaggatagccatga tctcactaaatccttcataacgaagagtggacctatatacggtagatgct tctttggagatcccatacaggtctccatacatcaaggaatttcgattngg ca
Download
page-top