Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884654
Length 757 bp
Fasta Format > whthls10c05
agatacattgattacaaggtctcacgatgaagatataaacctaatccggc ctactggcctccattatgacaaaacatgacatggccacttcaagaatcca aatcgtatgtcacctaggatatggctcagtaattgtaaccccattccaag atacgtcatcttccggtactagattagatcgagatctgccatgcatgtag cggcgttgcccatatcgtggagaagctggagatggtgattctgttccaaa aaagaatgcaggttgtgccggtggctgaagctccatggtgtcccttgtta acatgaaaatgacggtcgatatttgaggcctgtcgtcagggtccggttgg acacacagtagcccgatgtggatgcaccgtagcgcttggcttcgagggta tccattgagtgattcgtccatcatttgtgatattgttccttttgtccagt aattccacacatcactaatgaggttcacggtatccccataatctgaactg cagttccttctcctggttataatttcaaagactaatacaccaaaactgaa aatatcgatcttggttgacacacttccgtgtattgcgtactccggtgcca tataaccgagtgttccggcagctctagtggtttgagtatgagtgtgacct tcttgtagcagccttgccaatccaaagtctgcgatcttaggatccatctc ctcgtcaagaagaatattattagctttaaggtccctgtggattatccttg ggctgga
Download
page-top