Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884653
Length 782 bp
Fasta Format > whthls10c04
gtctctaccaaaaatttgcaactacacacggntatctaccaaggataatt tctttctagcagtatgaactttaatacaaccccaccagaattacaggcca aaaggagtcaaaagggaccgaactaacacctagacacctagggcgccgta agatccatgtgagcatccttttgcagaatcaccacttctctgttcgcacc taggtagaacagcaccctttctttgtgttgccagatgaatcggcaacatt gatggtggttccttgagtcggaggtccacttcctgcagcctcctgggcag cgagcgccttcttgcttatgatctgatggatgtcggaaaggatagtctga aacgccttctcgacgttcaaggcttccagtgccgaggtctcaaggaagga tagcccttccttctctgctaatgcctgcccttcttcctcttgaactgacc tcaggtggttaaggtcggatttgtttccaaccatcatgatgacaatgttg gagtcagcatggttacggagctcactaagccacctattgatgttttcaaa tgatagcttctttgttatgtcatacaccaaaagagctcccacagctcccc tgtagtaagcacttgtgattgcacggtacctctcttggccagcagtatcc catatctgagctttaatggtcttgccttctacctggagggtgcgggtggc gaactcgacgccgatggtggacttggactcgaggcagaactcgttgcggg tgaagcgggagaggatgttggacttgccgacg
Download
page-top