Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884650
Length 686 bp
Fasta Format > whthls10b24
atgcgtccgtgcatatacatagccaccgatagcattcacatacgagcatg ctttctcgagccatgttcgtacatgaacatggacatacacatattcttag gaacaaataagaaagataaatggagaaggaaaacccaaagcaatgtcaga gttgacaaaactgcaatggcactttatatatggcctgtcgtgagtgagct gtttaggccttgccggactcctcgcagcccggtggcttgaaggcgatgaa gctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcggacat aggcgtcagggtactccttcttgacctcctccacctcgttgatcacctgc gtggcgtcggtgcatccgaacataggcagcttccacattgtccagtaccg gccatcgtagtacccaggggatgcgttgtgctcacggaagatgaacccaa ccttgctgaactcgaggcaaggcacccacttggagcggatcaggtagtcg acctgcttaaggagggcctccgtgctgagcggtggcaagtaggacagggt ctcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatcc ttccaccgttgctgacgctgccgaggctagcgccgttggagcggcggctg acggggaggccggcggtggacttgagcccctggaaa
Download
page-top