Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884641
Length 104 bp
Fasta Format > whthls10b12
tctactggtaaacaagaacggcaaaatttcacattctgcaatcctgaatc ggaactagntttgcagaaaacagtgtaaaagaagatgaaatgttattgcc tgtg
Download
page-top