Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884639
Length 652 bp
Fasta Format > whthls10b10
acaatttgtctttgcttcaagtcaataatatgtagactggagcttcaaaa atctgatggtggtgggcgaagaagcgttcttgtttacaacagagggtgcg ggtttgtgcaagaattcttgagcccaagtacaactaacttgatccatgtc gttgaatcgcgacgacaacctcattacagcgttcacatctgtaagaactt gtagctgcagaccgcgtccgtaggcaataataacaatacctgtgttgaca tgggagagctacaaagggaatgctaggactanagacacatataggacagt ttgcttcgtcaccagaagaacttgctgatttatccttagagaaaggaagc aggaacttcttcactgaggatgagtttaagagggggagaagcaaaagcaa catttccgaaaactcattccagaccagctgccgattcatgtactcaaagc ttacggctctgttcatattggggctcccatacacaagtcttgctttcaga atcctttccacgagagttttataccttccaccataaagaaacgacaacag attaaaagaatgaaacagctctgtatagtccttcggcgtgctgcaccang ccccacgcacgacgtgctagtggtctctgttccagaatcacccccatcga cg
Download
page-top