Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884635
Length 237 bp
Fasta Format > whthls10b04
cccttctacgcccgcattgntagcaattgtgtgtactggggtctncaaag cattttgaatgatctggacaccaatcttttggtcaaagtttgctgtaggc aatttatccaagtcctttgacncataaagaagagcaacaccaccacctgg tacaataccctcctctactgcagcttttgtagcatttagcgcatctgtca ctctgtccttcttctcaccaacttctgcttcacttgc
Download
page-top