Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884634
Length 655 bp
Fasta Format > whthls10b03
aagttgcaaaatcatcttgcagcagaacaaaaaatgtgacagcctcattc acccacagtaaataacgatgaatccacatccacgctacaaaaagttctaa cctagatgttccatctaatcacattgttttgacatgagcctgggagcaag ttagaaatccatccctcccatgccgccgcctcccattgcgggtgccacct tgtcttccttggggatctcaacgatgatggcttccgtggtagtcatcaga gacgacacacttgcagcatcaaccagtgctgttctgatcaccttaagtgg gtcaatgataccagccttcaccatatccacatattcgcctttggcagcat catagcccaggtcggtattttcctgctccaagagcttgccaacaatgaca gccccttctacgcccgcattggtagcaattgtgtgtactggggtcttcaa agcattttgaatgatctggacaccaatcttttggtcaaagtttgctgtag gcaatttatccaagtcctttgacgcataaagaagagcaacaccaccacct ggtacaataccctcctctactgcagcttttgtagcatttagcgcatctgt cactctgtccttcttctcaccaacttctgcttcacttgctccaccaatct tcagg
Download
page-top