Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884633
Length 806 bp
Fasta Format > whthls10b02
tcagataatttactcgctacactgcagtaaaatctgaggacatatccata ataactagcgtaggttttagaatggtaaccgcggatcctatgatgacacc ataggaaaaactgctcgttttgcaaaactatagatagaattatacatagc caccaagcaacgttttggcctagtcaaaaatctggcaagccctgagcaaa ggctaattttgcctagtcgtccagctcaatgatcttcacgacagaggaat ctcccactttctggcacacgacgacgcggtcatgcgacttgatcacacca gatgctttgccgtggtcaagagcaaccttcaacactgattcatttgtagt gctagtagattcagccggatgacgtggatcggcaagcatgggaaagagac ctctaactatgagtgattgtcttgcctcaaatgcacctgtgaagctccac ttcaattgatttgttttcagacgaggaatgacaacagagaggacaggcat ggtgggcctgtacttggcaattagccttgcagcccgtccagatgaggtga agcaaatgatgaccgaagccttaactttaatagcagcccgcactgcagag gaagcaatagactccaagtgggtcatgggttctcccacatatttcacagt tcgcttaaagtacaaatcttggttgaagaccttctcagcctcagcacaaa ttctgcccactgttgaaatagtctcaactggatacaacccacggagagtc tcggcaccaaggagaatggcatcactaccatccagcaccgcatttgccac atcagt
Download
page-top