Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884630
Length 763 bp
Fasta Format > whthls10a22
agtattacagtatttgaagaaagacgcaagggaagacgaaaaagggcgac ccaagcatcacaagtatcttaagattggaattggggcatgtttcttggct gctaatcggtcgttggtaaaaatggcagttccagagctcaaacaactgga aacggtgtctaccattatgcgtgccactacattgcccatttgccacacat taaaaacagaacaaattctgaaagaacattacaccactcatcgatccaag ctaggggcatatacacaataatatagcgtagcactattgagtttggtact tctgtcagctccttgggtgtcgggaatcccattttacgtgttctagacga gctcatttagcacttttgtacatgttgtcaattgcgccctggtagtactt gagcaactgcggccgcttccttttatatgttggagtgatcaggtcacgct ccatgtcaaacggcactgggtcaaggtgcacagctcttatgaattcaaaa cctttgagcttcttctcttttcctgtttttgaaagttcccccaaaatata ttcttttgcttttggattctcacacagtgcctcaaaatcaccactggttc catttccctcagcccagctctcaagggcttccttgttaggattgactacg gcaacaaggaatgactcgaaactatttccatatacccatatcgagtctat agcagaaacaacaccgtaaatgttctccaaattttcaactgctacatatt ctccttgtgaaag
Download
page-top