Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884628
Length 456 bp
Fasta Format > whthls10a20
atcaaggagggaaagggtaaataatttgcaagggaaccatattttgtttg attaactttaggtacacattattcatccaaggttgggaaaccaaaaacaa aaacagaagccccagtttcccattgatacaaggaaactacacagcagtat ttctgagcttctgaaagagcttcgtcaacatccaagaaagatcaattgct gatcaatatcctagttggcggcgggcttgtcgacgagcttcttgtcacgg cgctccatggcgacgtcccacatgtcgttcccgatgtgcttcggcctgcc gtgcgcggccctgtggatgtagtactggccgttgcccatgatgcagagga agccgccgatgatgcccagcggcagcatggcctccagccagtgcaaccgg aacctcgccatcgggagccggacggggagacggcggacggatcggggcgg gcgggg
Download
page-top