Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884621
Length 718 bp
Fasta Format > whthls10a11
caatcgagcgtctaggaaaggctggctgggtagtcatacaccgaaacatg acagccgagctgaaatcacaggtatgggctacagtagtgactgactactc ataagctatatgcagatgtaaccaaatctacagatgatcggatggtggcc gtacgttaatcatgaacacacattccactactcagcatgcctcttggcca tcgtcttcttgaggccttttaggatcttggagaaccaaagcacattcatc acgaagattatgcaaggcgcaataagtaccagaaaatagccgaaggtgtt catcttcttaatctggtcataatgtacaaacatgtggtaaaacaagtaca tgaacaggattatccttgcaaccagccaagtaacaaccattgcaactccg ttaacaaggtaagctttggagttcttcattccagcaacatcaaggaacca tcttagattgattcctggcgttgtagtctcagtgatgagacccatgtata tgtatacatgtgcttccccagaaagcatagcgtacattgtagacataagt gacagcatgtggtggataacatactccattccaccaagggcagggtaaag ccaatatatcatggcaatgtctgtaatgaaatacccaatagagaccccta atgtaaaactggagaggcttgaaacttctcactgttactggtccatccag ctggtcanaaaacatacc
Download
page-top