Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884616
Length 332 bp
Fasta Format > whthls10a05
agcagccagaagaagttatcgaggcgcccctcgttcaggttgtcggggat ccacccgggtctccctcccctcgtcgtgaagtaggcgaccatggtgagga tgaaggcgctgaggtagttcccgagcgcggtggtgatgagctgcagcgcg ctgcagaggctcctcatggcgtccggcgactggtcgtagaagaactcgag cgccccgatgaaggtgaacacctccgaggcgccgaccaggaagtactgag ggatttgccacaggatgctcagcgggaccgggacgttctggtccaccagg tgcgcctccctggcgatggccagcctttttat
Download
page-top