Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ884613
Length 856 bp
Fasta Format > whthls10a02
acctagttgaacagtaaatatgaaaatagtattaaaatgagaccttttta gaacaagcttgctaatttttttgaaaatgagacttttttagaacaagcat gcttgtgtgtcctaactatgtacacatttaccagatctcatacaagctct ttcctctttcccctctcctcccgagccgcttgcggggccggcattggagg ggtaaactctagccactcaggaccctcctcccatgctcctcatgccgtcg ccgataatgccggttgggttgtgcaaagggccaggggcattcggccaggt gaatgaccatcgaggttggctgttgtgcggtcatgtggtgtaatgcgctt cgacagtgcggcagggaatggctactacatgtgagttgttggtggcggcg ctgactggatctgcatccatctggggcaaatctaagtcacggggttgtgg tcactgcaaggttgtctgcctggaaaggtgtgaccagctgatgcttgcga tgtcggcggccttagcgtgctcgtgttgggaatttgggctggagttgcta attcttggtcgtgccgaagatggagttggaatgcatttcctccgccatgc aaggtgttggtgcttcgccatgctatggccactatgacgaggtcttgcgg cggcggctgtgtgacttctaaagaaattgcttgcggtgtcggtggcctta gcgtgctggtgttgggaatctgggctggagttgctagttcttggtcgtgc ccgaagatgaagttggaatgcattttcctccgccgtgcagggtgttggtg cttcnccgtgctatggccacgatgacaaggtgttgcggggcanctgtgtg atttct
Download
page-top