Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872907
Length 703 bp
Fasta Format > whthls10j07
acgcatcatcgccaacgtcatagaggggcgcaaggccgccggcgttggtg cctccagcactgatgaggaggacctgctggatgtgttgcttaggctgcag caggaggactcgttggaattccctctaaccaccgagataataggcgccgt cttgtttgacatatttgcaggtgccacgtcgaccataggaactaccttga cgtgggctatgtcagagcttgtgcgcagtcctgaaactatggccaaggca caacaagaagtccgagaggttcttggccaagaccgagctgtcattactaa tagcgacctcgctaaacccgactacatgcagatgatcatcaaggaaaccc ttaggttccatccgcctgcttctctagttcttcgcgcgtccatagaggat tgtactatcatgggttatgacatccccaaaggcaccaatgtaaacattaa cgtcttcgcaatttctcgagatcctgcatactggaacaatcctgaagagt ttaggccggagaggtttgagaacaacaacacaaattacaacggcacatac tttgaattcactccctttggtgctgggcgacgacaatgccctgcgattca gtttagctcgtcggtcttggagatgacattgacaaatattctgtatcact tcaactggaagcttcctggtggtgctagcccgatttcgcttgacatgtcc gag
Download
page-top