Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872905
Length 425 bp
Fasta Format > whthls10h19
gctcttcctcaggtacgaagacctgctgctggacacgggcaagcacgtga ggcggctggcggagttcatgggccggccgttctcgcccgccgaggagggc gccggcgccgtggaggcggtggtggagctgtgcagcttcgagaagatgaa ggggctggaggtgaacaagaagggatcggcgggggcgtaccacgccatgc cccgggactctttcttcaggaaaggggtcgccggcgactgggtgaaccac atgacgccggagatggcgacgcggctggatgaggtcgtccgtgacaagtt ccgcggcacggggctcgcggctccgtgatctggacaatctgcatgcgtga ttcgattgtactgtatgcttggctgctggtgcccgttgatttagaataaa gatgctgttctcggcaaaaaaaaaa
Download
page-top