Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872901
Length 733 bp
Fasta Format > whthls10h11
cctgctgcggaattatccctgcagaaacaactactgatacaatggtcgaa gaagttgatgtggagagggaacctgcagcagcagcagcaactactgatac gacgttatcagtgacaacgctgccaaatgtgatttccactaaagagactg gtgttacttctgggatggttgatgatcacgaactaatgaaaagcgagcct gctgcagaagctagccctgcagcaatagctactgatacgacggccgacga ggttgatgtcgaaagtgagcctgcggagaattttgatagccctgtgccat cacctaccaatgccatttctactgtacaagttgatggtggtcaacatgat gatgaacaaggaaaatattttgctaacaccaaggatgcaaaatattttgc taagaaacatggtctcagcgctcatgtgacagatcgggtgaacatgggaa gttccaaagaggagatggaaggaatggcaggtttagagggtcagcaaatg gaagacgccaccaagaaccaaggcgtacgaaacaaacagcgtctgcgcac gaggttgtcatcgctgctggcaattggtgtctttcgccaaagaagtcgac gggggatgttggtgccttgactaggttaatcttgctcaggacagggctgg agtatgctttgagtatcaggttggtggcgttttaactaattgtcgcttct gttgcttcgacggctcagctgtcttgttgagcc
Download
page-top