Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872890
Length 767 bp
Fasta Format > whthls10f03
atcagggattggaccttactacgttgacaactaaagaattgatagcaaag tacggcttagttgatgatacagtggatttcattggccacgcgcttgctct ccatagggatgatcgtcacctcaatgaaccagcacttgatactgtgaaaa ggatgaaattatattcggagtctcttgcacgttttcaagggggctcgcct tatatttatcctctatatgggctgggtgagctgccacagggttttgcacg tctaagtgctgtttatggtggcacttacatgttaagtaagccagaatgca aggttgaattcgatatggaaggaaaagcgtgtggtgttacatcagaaggt gaaaccgcaaaatgcaagaaagttgtctgcgatccttcgtacttgaccaa caaggtcaggaagatcggcaaagttgcacgtgcaattgctattatgagcc atccaatcccaaatacaaatgagtcccactcagtccagattattttgcca cagaaacaacttggacgcaattcagacatgtatgtcttctgttgctcata cacccacaacgtcgcaccaaaagggaagttcattgcatttgtctctgcag aagcggagagtgataatatacaatccgaacttaagcctggcattgatcta cttggtccagtagatgagctcttttttgatatgtatgacagatatgaacc agtgaacgaaccatctcttgataattgcttcatctcaccgagctatgatg ctaccacacattttgag
Download
page-top