Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872889
Length 755 bp
Fasta Format > whthls10f01
aggctctttcgtcctcctcctcaagatgcagatctttgtgaagaccctca ccggcaagaccatcaccctcgaggttgagtcctcggacaccatcgacaac gtcaaggctaagatccaggacaaggagggcatccctccggatcagcagcg tctcatcttcgctggcaagcagctcgaggatggccgcaccctggctgact acaacatccagaaggaatccacactccacctggtgctcagactccgtggt ggcatgcagatcttcgtcaagaccctgaccggcaagaccatcaccctgga ggttgagtcctctgacaccatcgacaacgtcaaggccaagatccaggaca aggagggcattcccccggaccagcagcgtctcatttttgctggcaagcag ctcgaggatggccgcacgctcgctgactacaacatccagaaggaatccac actccacctggtgctcaggctccgtggtggcatgcagatcttcgtcaaga ccctgaccggcaagaccatcaccctggaggtcgagtcctctgacaccatc gacaacgtcaaggccaagatccaggacaaggagggcatcccaccggacca gcagcgtctcatctttgctggcaagcagcttgaggatggccgcactttgg cggactacaacatccagaaggagtccacacttcacttggtgctccgtctg cgcggtggccagtaagctcctggccatggatctgcttctgtctctgggtt cacaa
Download
page-top