Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872887
Length 133 bp
Fasta Format > whthls10d21
gtccacaagcacaccaagcccgggatcctctccatggccaacgcgggccc caacaccaacggctcccagttcttcatctgcaccgtcccctgcaattggc tcgacggcaagcacgtggtcttcggcgaggtcg
Download
page-top