Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872886
Length 602 bp
Fasta Format > whthls10d19
cgcccgcatcaccatggccgacctcacccgcacacccacttagctccccg ctgtacctgctttctccagaagaacaaccgccgactacctcgtctactgg agccacctgttggagttgaagctctctgcatcaaccacgacgatgtcttc ttcatcctcgtcaccgaccgctgccctgctgttgattcccctatctccga acctccccagagccacccgggcctcgtcgagctcgccaccggccctcccc atgactacgagaccgacgttgctgctgcccagttcgactacggagttgac gacccctccttcttgccagagcaaccagtcgttgaagcccaggagacgga cgccactgtcgacgaagactcctactaccactagaggtgcctactactac atgcaggccgctgacgatgaccaggagtagttaggaggatcccatgcagg aggcctgcgcctctttcgatctgtatcccagtttgtgctagccatcttaa ggcaacttgtttaacttatgtctgtactcagatattgttgattccgctga ctcgtttatcttcgagcacttgtattagagccctcaaggcccttggcttg ta
Download
page-top