Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872880
Length 666 bp
Fasta Format > whthls10d01
cccccacaagccccgcttctacctgcaggacctggcggtgctctgcctca acgtcacgccgcccacctccgcctacctcttcaccaccatgcaggccacc gtggccgcccgcaaccccaacgaccgcgtcggcgtctactacgacgaggc ggacatgtacgcgcagtacaagggcgtggccatcaccgtgcccacccggc tccccgtcgcctaccagggccaccgggaccagtccgtgtggtcgccgtat ctgaggtccatggacagcgtcgtgctcccgccggtgctcgccgtggcgct ggcgcaggacgagacggccgggtacgtgctggtggacgtcaaggtggacg gctttgtgcgctggaaggtgggcacctggatctccggccactaccacctc cgcgtcaactgcccggccctcatcagggtgaacgagggcaagggcagcta cggcgccaccaccggcggcggccccgactacttccggttccagcaggccg ccgcctgcgccgtcgacgtctgatcaattcatgcatgcatcatcggttct tggacctccaccgatccatattcatgcatgtgtccaaatccaaattcagg ggatggaatcgattgatttgcttttctctctctctctctctctctctctc tctctctctctctctc
Download
page-top