Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872878
Length 466 bp
Fasta Format > whthls10b19
gacggctcatcaccaaaatccttgagatacattggaagcatggttgccga tgttcatcgtaccctgctctacggaggcatatttctgtaccccgccgaca agaagagccccaacgggaagcttcgtgttctgtacgaggttttccccatg tcgttcctgatggagcaagccggaggccagtctttcaccggcaaacagcg tgcccttgaaatcgttcctgctgagatacaccagaggtctccgatattcc tcgggagctacgatgatgtggaggagattaaatcactgtacgcttcggag tcgagcaccgcctgatctgagtacccgaagacacatacacatgctctgca tcgtgttccgcgttgtgacaaaactccctaggtagtgttacatggtgatt ctgagatctttgtcatggcctcgatgtaacaatacctgtgtatacatata tttgacaaaaaaaaaa
Download
page-top