Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872872
Length 759 bp
Fasta Format > whthls10b01
cggcgttgaggagcttctcctcgagcggtgacggcgagccgtcgcagctg cagcggatgggtgccgggcggctcctcatggcgctcaccatggcggtggc agcgctcgtggaaatgaagcggctcgacagcgcggcccgtggggaagaga tcagcatctcgtggcagctgccccagtatttcttccttgccggcggggag gtgttctgctacatcgcgcagctagagttcttctttgacgaggcgccgga caccatgaagagcatgtgcacgtcgctggctctgctcaccatcgcgctgg ggagctacatgagctccttcatctacgccatcgtggaggccttcacggcg acgggagacagccccgggtggatctccgacgacctcaacaagggccacct cgactacttcttctgggccatggctgcaatgtgcacgctcaacttcgtcg tgtacagcggcatcgtcaagaactacaggctcaagacggtcatctcgtga acgctcgcccaaggattcaagattacattgcacaatcgccaattggtgaa cagtaaatagcttagccaggtacatatattgatatatacacaagacacat taggaagaaaatgtaggacatcacttctctttcttttcatggccgtagtg taatcctatggcaggaacattttttcgaatttttgttggtggcttttctt ggattgtagaaagattacaagatggcagtatgaatgtgtgcttctcttgt attttaaaa
Download
page-top