Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ872854
Length 674 bp
Fasta Format > whthls10k15
cggacattcaggaggtcaggatcatcaggcatggtctggggcgagaggct catgtcggatgagcatagccagtggacctcgggggaaccagagttcaggg agctacggcactcccgcagcgttgggtccgtcggggcgcagcgcaggcgc aacgatggcaccgagcgtggcggccaggcgttccggacacggcgtgtagc cccggccatggatccagcgtcgcccaaggttcctggctgcatcttctgtg ggattttcaggaagacagcaccttcacagccatctaaggccagaaggtac cactagagtgatctgtgtattcatcgaccgtatgtgtgactgggttacct ggttctggagcttgtgaagttcaggtccattgagtagtactcagtgatac gctcgtatagttgcatgcagtttggataagtttgagcatatctgtttatt aaggtgttatgcatatttttgctgatttctctaccacttgatagtttgct gatgcaactgctttcttgagtgaccgcctcgtctagctttgtgcgcatga tagaaattgtgcatgtcggctgcagcacatatcttgtataagccactgta catgaacatgatgttttcatttggttctgtatctggatcgtctaaaggtg actatatttgtaaatgttgtccgt
Download
page-top